RegulonDB RegulonDB 10.9: Gene Sequence
sodC gene sequence


Size: 522        A: 139  T: 107  G: 144  C: 132

Fasta

 

>sodC E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgttttagtctggctattctggcgctggttgttgcaaccggcgcacaagctgcc
agtgaaaaagtcgagatgaacctcgtcacgtcgcaaggggtagggcagtcaattggtagc
gtcaccattactgaaaccgataaaggtctggagttttcgcccgatctgaaagcattaccc
cccggtgaacatggcttccatattcatgccaaaggaagctgccagccagccaccaaagat
ggcaaagccagcgccgcggaatccgcaggcgggcatcttgatccacaaaataccggtaaa
catgaagggccagaaggtgccgggcatttaggcgatctgcctgcactggtcgtcaataat
gacggcaaagctaccgatgccgtcatcgcgcctcgtctgaaatcactggatgaaatcaaa
gacaaagcgctgatggtccacgttggcggcgataatatgtccgatcaacctaaaccgctg
ggcggtggcggtgaacgctatgcctgtggtgtaattaagtaa
              
                            

Download fasta file
RegulonDB