RegulonDB RegulonDB 10.9: Gene Sequence
ydhF gene sequence


Size: 897        A: 203  T: 224  G: 248  C: 222

Fasta

 

>ydhF E. coli K12. Version NC_000913.3 GI:556503834
atggttcagcgtattactattgcgccgcaaggcccggagttttcccgttttgtgatgggc
tactggcgattgatggactggaatatgtccgcccgccagctggtcagttttattgaagag
catctggatctcggcgtgaccaccgtggaccatgctgatatttatggtggctatcagtgc
gaagcggcgtttggcgaggcactgaaactggcacctcacctgcgtgaacggatggaaatc
gtcagtaaatgcggtatcgcgacgaccgcgcgtgaagaaaacgtcattggtcattacatc
actgaccgcgatcacatcattaagagcgccgaacagtcgctaattaatctcgcgaccgat
catctggatttgctgttaatccaccgaccagacccgttaatggatgccgatgaagtggcg
gacgcgttcaaacatctgcatcagagcggcaaagtgcgtcattttggcgtatcgaacttt
acgcctgcgcaatttgccctgttgcaatcacgtctgccgtttacccttgccactaatcag
gtggaaatatccccggtgcatcagccgttactgctggatggcacgctcgaccaactacaa
caactgcgtgttcgtccgatggcgtggtcctgccttggtggtggtcgtctgtttaatgat
gattatttccagccgctgcgtgatgaactggctgtggtggcagaggagttaaacgcgggc
tcgattgaacaggtggtttacgcctgggtattacgtttaccatcgcagccgctgccaatt
atcggttcaggtaaaattgagcgcgtacgggcagctgtcgaagcagaaacactgaaaatg
acccgtcaacaatggtttcgtatccgtaaagcggcactggggtacgacgtaccgtaa
              
                            

Download fasta file
RegulonDB