RegulonDB RegulonDB 10.9: Gene Sequence
ydhL gene sequence


Size: 240        A: 59  T: 57  G: 69  C: 55

Fasta

 

>ydhL E. coli K12. Version NC_000913.3 GI:556503834
gtggcggagcaattagagttctttcccgtccagagcccgtgccggggaatttgccagtct
gacgaacgcgggttttgtcgcggctgttttcgtagtcgtgatgagcgttttaactggaat
aaaatgagcgatggcgaaaaacaagaggtgctgcgcctttgtcggcagcgattaatgcgc
aaattacgcgcaaataagccagcgtcatcagacgaaccggagcaaccatcactcttttga
              
                            

Download fasta file
RegulonDB