RegulonDB RegulonDB 10.9: Gene Sequence
nemR gene sequence


Size: 600        A: 153  T: 133  G: 154  C: 160

Fasta

 

>nemR E. coli K12. Version NC_000913.3 GI:556503834
atgaacaaacacaccgaacatgatactcgcgaacatctcctggcgacgggcgagcaactt
tgcctgcaacgtggattcaccgggatggggctaagcgaattactaaaaaccgctgaagtg
ccgaaagggtccttctatcactactttcgctctaaagaagcgtttggcgttgccatgctt
gagcgtcattacgccgcatatcaccagcgactgactgagttgctgcaatccggcgaaggt
aactaccgcgaccgcatactggcttattaccagcaaacactgaaccagttttgccaacat
ggaaccatcagtggttgcctgacagtaaaactctctgccgaagtgtgcgatctgtcagaa
gatatgcgcagcgcgatggataaaggtgctcgcggcgtgatcgccctgctctctcaggcg
ctggaaaatggccgtgagaaccattgtttaaccttttgtggcgaaccgctgcaacaggca
caagtgctttacgcactgtggcttggcgcgaatctgcaggccaaaatttcgcgcagtttc
gagccactggaaaacgcgctggcccatgtaaaaaacattattgcgacgcctgccgtttag
              
                            

Download fasta file
RegulonDB