RegulonDB RegulonDB 10.9: Gene Sequence
nemA gene sequence


Size: 1098        A: 259  T: 252  G: 305  C: 282

Fasta

 

>nemA E. coli K12. Version NC_000913.3 GI:556503834
atgtcatctgaaaaactgtattccccactgaaagtgggcgcgatcacggcggcaaaccgt
atttttatggcaccgctgacgcgtctgcgcagtattgaaccgggtgacattcctaccccg
ttgatggcggaatactatcgccaacgtgccagtgccggtttgattattagtgaagccacg
caaatttctgcccaggcaaaaggatatgcaggtgcgcctggcatccatagtccggagcaa
attgccgcatggaaaaaaatcaccgctggcgttcatgctgaaaatggtcatatggccgtg
cagctgtggcacaccggacgcatttctcacgccagcctgcaacctggcggtcaggcaccg
gtagcgccttcagcacttagcgcgggaacacgtacttctctgcgcgatgaaaatggtcag
gcgatccgtgttgaaacatccatgccgcgtgcgcttgaactggaagagattccaggtatc
gtcaatgatttccgtcaggccattgctaacgcgcgtgaagccggttttgatctggtagag
ctccactctgctcacggttatttgctgcatcagttcctttctccttcttcaaaccatcgt
accgatcagtacggcggcagcgtggaaaatcgcgcacgtttggtactggaagtggtcgat
gccgggattgaagaatggggtgccgatcgcattggcattcgcgtttcaccaatcggtact
ttccagaacacagataacggcccgaatgaagaagccgatgcactgtatctgattgaacaa
ctgggtaaacgcggcattgcttatctgcatatgtcagaaccagattgggcggggggtgaa
ccgtatactgatgcgttccgcgaaaaagtacgcgcccgtttccacggtccgattatcggc
gcaggtgcatacacagtagaaaaagctgaaacgctgatcggcaaagggttaattgatgcg
gtggcatttggtcgtgactggattgcgaacccggatctggtcgcccgcttgcagcgcaaa
gctgagcttaacccacagcgtgccgaaagtttctacggtggcggcgcggaaggctatacc
gattacccgacgttgtaa
              
                            

Download fasta file
RegulonDB