RegulonDB RegulonDB 10.9: Gene Sequence
gloA gene sequence


Size: 408        A: 110  T: 88  G: 115  C: 95

Fasta

 

>gloA E. coli K12. Version NC_000913.3 GI:556503834
atgcgtcttcttcataccatgctgcgcgttggcgatttgcaacgctccatcgatttttat
accaaagtgctgggcatgaaactgctgcgtaccagcgaaaacccggaatacaaatactca
ctggcgtttgttggctacggcccggaaaccgaagaagcggtgattgaactgacctacaac
tggggcgtggataaatacgaactcggcactgcttatggtcacatcgcgcttagcgtagat
aacgccgctgaagcgtgcgaaaaaatccgtcaaaacgggggtaacgtgacccgtgaagcg
ggtccggtaaaaggcggtactacggttatcgcgtttgtggaagatccggacggttacaaa
attgagttaatcgaagagaaagacgccggtcgcggtctgggcaactaa
              
                            

Download fasta file
RegulonDB