RegulonDB RegulonDB 10.9: Gene Sequence
mepH gene sequence


Size: 816        A: 255  T: 171  G: 181  C: 209

Fasta

 

>mepH E. coli K12. Version NC_000913.3 GI:556503834
gtggcgcggataaaccgtatttcgatcacgctctgtgctttactttttaccaccctgcct
ttaacgcctatggcccatgcttcaaagcaagccagggagagttctgctaccactcatatc
accaaaaaagcagataaaaagaaaagcacggcaaccaccaaaaagacccagaaaacagcg
aaaaaagccgccagtaaaagtacgaccaaaagcaaaaccgcttcttccgttaaaaaatct
tccattaccgcttctaaaaacgccaaaactcgcagcaaacacgccgtcaataaaacggcc
tcagccagctttaccgaaaagtgtaccaaacgtaagggctataaatcgcattgtgtgaaa
gtcaaaaatgccgcgtcaggaactcttgccgacgcgcacaaagcgaaggtgcaaaaagct
acgaaagtggcaatgaataaactgatgcagcaaattggtaagccatatcgttggggtggc
agctcaccgcgtaccggttttgattgcagcggcctggtttattacgcttataaagatttg
gtgaaaattcgtattccgcgtacggcgaatgaaatgtatcacctgcgtgatgcagcgcca
atcgaacgtagtgaactgaaaaacggcgacctggtctttttccgtactcagggacgcggc
acagccgatcatgtcggcgtgtatgtcggcaacggcaaatttattcagtcaccgcgcaca
ggtcaggaaattcaaatcacttctctcagtgaagactactggcagcgccactatgttggc
gctcgtcgggtaatgaccccaaaaacacttcgctaa
              
                            

Download fasta file
RegulonDB