RegulonDB RegulonDB 10.10: Gene Sequence
ydhP gene sequence


Size: 1170        A: 223  T: 323  G: 350  C: 274

Fasta

 

>ydhP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattaactatccgttgctggcgctggcgattggcgcgtttggtatcgggacaacg
gagttctcgccaatgggcttgttgcccgtcattgcgcgcggtgtggatgtctcgattccc
gctgccggaatgttaatcagtgcctatgcagttggcgtaatggttggcgcgccgctgatg
acgcttctactttctcatcgtgcccgccgcagtgcgttgattttcctgatggcaattttc
acgctcggcaacgtactttccgccatcgcgccggattatatgaccctgatgctttcacgc
attttgaccagcctgaatcacggagcattttttggtttgggttcagtcgtggccgcaagc
gtggtgccaaaacataaacaggccagcgcagttgccactatgtttatggggttaaccctg
gcaaatatcggtggcgtgccggcggcgacctggttgggtgaaaccatcggctggcggatg
tcatttctggcaacggcggggctgggagtgatttcaatggtaagtctgttcttctcatta
cctaaaggtggtgcaggggcacgacctgaagtgaaaaaagagctggcggtattaatgcgt
ccgcaggtgctgtctgcattgctgacgacggtactgggagctggtgcaatgtttactctc
tacacctatatctctccggtactgcaaagtattacccacgcaacaccggtgttcgtcacg
gcaatgctggtgctgattggtgtcggattctctatcggtaactatctcggcggcaaactg
gcagatcgttcagttaacggcacgttgaaaggctttttgttgttgttgatggtgattatg
ctggcaatcccgttcctggcccgcaatgagttcggcgcagctattagcatggtggtgtgg
ggcgcagcaacctttgcggtcgtaccgccgttacagatgcgcgtgatgcgtgtcgccagt
gaagcgccaggtctgtcttcatcagtcaatattggtgcctttaatcttggaaatgcgctg
ggagcagctgctggtggtgcggtaatttccgctgggctgggatacagctttgtgccggtg
atgggagcgattgtcgcgggactggcattattgctggtgtttatgtcagccagaaaacaa
cctgaaacagtttgcgttgctaacagctaa
              
                            

Download fasta file
RegulonDB