RegulonDB RegulonDB 10.9: Gene Sequence
ydhS gene sequence


Size: 1605        A: 433  T: 404  G: 395  C: 373

Fasta

 

>ydhS E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaattgctattgtgggtgccgggcctacggggatctacaccttattctcgctt
ctacagcaacaaactccactttctatttctatcttcgagcaggctgacgaggccggtgtc
gggatgccatacagtgatgaggaaaactcaaaaatgatgctggcaaatattgccagtatt
gaaataccgccgatttattgtacgtatctcgaatggctacaaaagcaagaagacagccat
ctccagcgttatggcgttaaaaaagaaaccttgcacgatcgtcagtttttaccgcgaatt
ctgctgggcgaatatttccgcgatcaatttttacgactagtagaccaggcacgacagcaa
aaatttgcagtggctgtttatgaatcatgccaggttaccgatctgcaaattacaaatgct
ggcgtcatgctcgctacaaatcaggatttacccagcgagacgtttgatttagcggtgatc
gccacgggtcacgtctggcctgatgaagaagaagcaacccgaacgtattttcccagcccg
tggtcaggcctgatggaagcaaaggtcgatgcgtgtaacgtgggtattatgggaacatcc
ttgagcggactggatgcggcaatggcagtggctattcagcatggttcgttcattgaagat
gataaacaacacgtcgtttttcaccgcgataacgcaagtgaaaagctaaatatcacgttg
ttgtcgcgcacgggtattttacccgaagccgatttctattgccctattccctacgagccc
ttacacatcgtcaccgatcaggcattaaatgctgagattcaaaaaggcgaagagggcctt
ttggatcgggtatttagattgatagtagaggaaatcaagtttgctgatccagactggagt
caacgcatagccttagagagcctgaatgtcgattcctttgctcaagcctggtttgccgag
cgcaaacaacgcgacccatttgactgggcagaaaaaaatctccaggaagtcgaacgcaat
aaacgagaaaaacatactgttccctggcgttatgtcattctgcgcctgcatgaagccgta
caggaaattgttccacatctgaatgaacacgaccataaacggttcagtaaaggccttgcc
cgggttttcatcgataattatgcggcaatcccttcagagtctattcgtcgcctacttgcc
ttacgtgaagcgggaatcattcatattctcgccctcggtgaagactacaaaatggaaatt
aatgagtcgcgcaccgtcctgaaaacggaagacaacagctactcgtttgacgtttttatt
gatgcccgcggacaacgtccgcttaaagtgaaagatatccctttccctgggctacgcgag
caattacagaaaacaggggatgaaatccctgatgttggcgaagattatacgttacagcaa
cccgaagatattcgtgggcgcgtagcgttcggcgcgttgccctggttgatgcacgaccag
cctttcgttcagggacttacggcatgtgcagaaattggtgaggcgatggctcgggcggtc
gtaaagcctgcatcccgtgctcgtcggcgtctttcgtttgattaa
              
                            

Download fasta file
RegulonDB