RegulonDB RegulonDB 10.8: Gene Sequence
ydhT gene sequence


Size: 813        A: 200  T: 183  G: 243  C: 187

Fasta

 

>ydhT E. coli K12. Version NC_000913.3 GI:556503834
atgatcattacacaagcagacctgcgagaatggcgtatcggagcggtgatgtatcgctgg
ttcctgcgccatttcccacgcggcggtagttatgccgatattcatcatgcactgattgag
gaaggatatacggactgggcggagagtctggttgagtatgcgtggaaaaaatggctggcg
gatgaaaacttcgcgcatcaggaagtttcctctatgcaaaaactggccacagaccccgga
gagagaccattttgcagtcagtttgcccgcagcgacgatcatgctcgcatcggctgttgt
gaggataacgccagaatcgcaaccgctgggtatgccgcgcaaattgccagtatgggttat
agcgtgcggattggaagtgtcggctttaacagtcacattggcagctccggtgaacgcgca
cgggttgctgtaaccggtaattcttcgcggataagcagcgctggagatagcagtcggatt
gcgaataccggaatgcgagtacgcgtttgtacattgggtgaacggtgtcatgtcgccagt
aatggtgacctggtgcaaatcgccagctttggcgcaaacgccagaattgccaacagcggc
gacaatgtacacatcattgccagcggtgaaaattcaacggtagtgagcacgggcgtggtc
gactcaattattctcgggccaggaggaagcgccgcactggcatatcatgacggcgaaaga
gttcgcttcgccgtcgccattgaaggtgaaaacaatattcgagccggagtccgctatcgt
cttaatgaacagcatcagtttgttgagtgctga
              
                            

Download fasta file
RegulonDB