RegulonDB RegulonDB 10.9: Gene Sequence
fumD gene sequence


Size: 210        A: 70  T: 42  G: 61  C: 37

Fasta

 

>fumD E. coli K12. Version NC_000913.3 GI:556503834
atgggaaatcggacaaaagaggatgaactgtaccgagaaatgtgcagagttgtcggtaaa
gttgtgctggaaatgcgcgatctggggcaggaaccaaagcatattgttatcgcaggcgta
ttacgtacagcattagccaataaacgcattcagcgcagtgagctggaaaagcaggcgatg
gaaaccgtcattaacgcactggtaaaatga
              
                            

Download fasta file
RegulonDB