RegulonDB RegulonDB 11.1: Gene Sequence
ldtE gene sequence


Size: 1005        A: 258  T: 226  G: 271  C: 250

Fasta

 

>ldtE E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgcgcgtctttgcttacactcacgcttatcggcgcttttagcgccatccaggct
gcctgggcggttgattatccgctaccaccaaccggaagccgactggttgggcaaaatcaa
acgtatacggtgcaagaaggggataaaaaccttcaggctattgcccgacgttttgatact
gcggcaatgttgatccttgaagccaataacactatcgccccggtgccaaaacctggtacg
acgataactattccttcacaactgttattacctgatgcaccgcgtcaggggattatcgtt
aaccttgcagagctgcgcctttattattatccgccgggagaaaatattgtgcaggtttat
ccaataggtattggattgcaggggctggaaacgccggtgatggaaacgcgtgttgggcag
aaaatccctaacccaacctggacgcctacggcaggcattcgtcagcgttcgctggagcgt
ggcattaaattaccgccagtcgttcctgccggaccaaataacccgctaggacgttacgca
ctgcgcctcgcgcatggtaatggcgaatacctcattcatggtaccagtgcgccggacagc
gtcggtttgcgcgtcagttcagggtgtattcgcatgaatgcaccggatattaaagccttg
ttctccagcgtgcggacgggaacgccggtgaaagtgatcaacgaaccggtgaaatattcc
gtggagcctaacgggatgcgttatgttgaagtacatcgaccactatcggcagaagaacag
cagaacgttcagacaatgccatacacactgccagcaggctttacgcaatttaaagacaat
aaggctgtagatcagaagttagtcgataaagcgttgtatcgtcgggcagggtatccggtt
tcggtgagcagtggagcaactcccgcagccagcaatgcgccttcagtagagtcagcgcag
aatggtgaaccagagcaagggaatatgttacgcgtgacgcagtag
              
                            

Download fasta file
RegulonDB