RegulonDB RegulonDB 11.0: Gene Sequence
ydiH gene sequence


Size: 189        A: 49  T: 56  G: 33  C: 51

Fasta

 

>ydiH E. coli K12. Version NC_000913.3 GI:556503834
atgtctactcaacttgatcccacccagctggccattgaatttttacgccgtgaccagagc
aatctttcacctgcccaatatctcaaacgtctgaaacaactagaacttgaatttgctgac
ctgcttactctctcttctgctgaattaaaagaagaaatctactttgcctggcgtctgggc
gtgcattga
              
                            

Download fasta file
RegulonDB