RegulonDB RegulonDB 11.0: Gene Sequence
ydiL gene sequence


Size: 357        A: 102  T: 92  G: 80  C: 83

Fasta

 

>ydiL E. coli K12. Version NC_000913.3 GI:556503834
atgaacgcttatgaactccaggcactccgccatatttttgccatgactattgatgaatgc
gcgacctggattgcccagaccggtgacagtgaaagctggcgtcagtgggaaaatggcaag
tgtgccattcctgatcgtgtagtcgagcaactgttggctatgcgtcagcaaagaaaaaaa
catcttcatgccatcatagagaaaataaataaccgcatcggcaacaacaccatgcgtttt
ttccccgacttaaccgcatttcaacgagtctaccctgatggcaattttattgactggaag
atctatcaatcggtagctgctgaattatatgcacacgatctggagcggctttgttaa
              
                            

Download fasta file
RegulonDB