RegulonDB RegulonDB 11.0: Gene Sequence
ydiO gene sequence


Size: 1152        A: 301  T: 253  G: 312  C: 286

Fasta

 

>ydiO E. coli K12. Version NC_000913.3 GI:556503834
atggatttttctttaactgaagaacaagaactgctgctggccagtattcgcgaactgatt
acgactaactttccggaagagtatttccgcacctgcgatcaaaacgggacatatccgcgt
gagtttatgcgggcgctggcggataacggtatttccatgcttggcgtgccggaagaattt
ggtggtatccctgcggattacgtcacccaaatgctggcgctgatggaagtgtcaaaatgc
ggtgctccggcatttttaattaccaacggtcaatgtattcacagtatgcgccgtttcggt
tctgcagagcagctacgtaaaacggcagagagcaccctggaaacgggtgatcccgcctat
gccctggcgttgacggaaccaggtgctggctcagataacaacagtgccactaccacttac
acgcgtaaaaacggcaaggtctacatcaacggacaaaaaacctttattaccggtgcgaaa
gagtacccgtatatgctggtgctggcgcgcgatccgcaaccgaaagatcccaaaaaagcc
ttcaccctgtggtgggtcgactccagtaagcccggcattaagattaacccgctgcataaa
atcggctggcatatgctcagcacctgcgaagtctatctcgacaacgtggaggttgaagag
agcgacatggtgggcgaagaaggaatgggtttcctcaatgtgatgtacaactttgagatg
gagcgcctgatcaacgccgcgcgcagcaccggctttgccgaatgcgcctttgaagatgcc
gcccgctatgccaaccaacgtatcgcttttggtaagcccattggtcataaccagatgatc
caggaaaaactggcgctgatggcgattaagatcgacaacatgcgcaacatggtgctgaaa
gtggcatggcaagccgatcagcatcagtcactgcgcaccagcgcggcgctggcaaaactg
tactgtgcacgtaccgcaatggaagtcattgatgatgcgattcaaatcatgggcggtctg
ggctataccgatgaggcgcgcgtctcccgcttctggcgtgatgtccgttgtgaacgtatc
ggcggcggtacagacgaaattatgatttacgtagcaggtcggcagatcctgaaagactat
cagaacaaataa
              
                            

Download fasta file
RegulonDB