RegulonDB RegulonDB 11.0: Gene Sequence
ydiP gene sequence


Size: 912        A: 263  T: 266  G: 203  C: 180

Fasta

 

>ydiP E. coli K12. Version NC_000913.3 GI:556503834
atgtatcaacgctgttttgataacgccagtgaaacgctgtttgtcgccggtaaaacgcca
cggctttcacgttttgcatttagcgatgatccaaaatgggagtccggacatcacgttcat
gacaatgaaaccgagttgatttacgtcaagaaaggggttgcaaggtttaccatcgattct
tcgttatatgtcgcacatgcggatgacattgtggtgatagaacgcggcaggctgcatgcg
gtggcctctgacgttaacgatccggcaacgacgtgtacctgtgcgctgtacggctttcag
tttcagggggctgaggaaaatcagctactgcaaccgcattcttgtccggtaattgccgcg
gggcagggaaaagaagtcataaaaaccttatttaatgagctaagtgtgattttgccgcaa
agtaaaaatagccaaacatcttcgttatgggatgcatttgcctatacgttagccattctt
tactacgaaaattttaaaaatgcttatcgttcggagcaggggtatattaaaaaagatgtt
ctgataaaagatattcttttctatctgaataataattatcgcgaaaaaatcactttagaa
cagttatcgaaaaaatttcgtgccagcgtcagttatatttgccatgaatttaccaaagag
tatcgtatttcccctattaactatgttattcaacggcgtatgacggaagcaaaatggtca
ctcactaatactgaattatcacaggcagagatctcctggcgtgtgggttatgaaaatgtc
gatcactttgccaaactgtttttgcgccatgtcggttgttcgcccagcgattaccgtaga
caatttaaaaactgttttgcggaacaagaaatcctatctgaatttcctcaaccggtaagt
cttgttggataa
              
                            

Download fasta file
RegulonDB