RegulonDB RegulonDB 10.9: Gene Sequence
ydiQ gene sequence


Size: 765        A: 199  T: 173  G: 199  C: 194

Fasta

 

>ydiQ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaataataacctgctttaagctggtgcctgaagaacaggacattgttgtcactcca
gaatacaccctgaatttcgacaatgccgacgccaaaatcagccagttcgatctcaatgcc
attgaagctgcaagccagctcgcaacagatgacgatgagatagccgcgctgaccgttggc
ggctcattgttgcagaactcgaaagtgcgcaaagacgtgctatcccgcgggccgcacagc
ctgtatttggtgcaggatgcgcaacttgaacatgcactgcctctcgataccgcaaaagcg
ctggcggcagcaattgaaaagatcggcttcgatttactgatctttggtgaaggttccggc
gacctttatgcccagcaggttggcttgctggtcggagaaattctgcaacttccggtgatt
aatgcagtgagtgctattcagcgtcagggcaatacactggtgattgaacgcacgcttgaa
gatgatgttgaagttattgaactctctgttccagccgtgctctgcgtcacctccgatatt
aacgtgccacgcattccttcgatgaaagccattctcggcgcgggtaaaaaaccggtaaat
cagtggcaggcaagtgatattgactggagccagagcgcgccacttgctgaactggtcggc
attcgcgtaccgccgcaaacagaacgtaagcacatcattatcgataacgattcgccggag
gccattgccgagctggcggaacatctgaagaaagccctgaactga
              
                            

Download fasta file
RegulonDB