RegulonDB RegulonDB 10.9: Gene Sequence
ydiR gene sequence


Size: 939        A: 228  T: 208  G: 267  C: 236

Fasta

 

>ydiR E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaattaaacagcgtctgggtctttagcgataatcctgaacgttatgctgaactg
tttggcggcgctcagcaatggggccaacaggtgtatgccattgtacaaaataccgaccag
gcgcaggcagttatgccttatggtccaaaatgtctttatgttcttgcgcaaaacgacgcg
ctgcaacgcactgaaaattacgccgaaagcattgctgccctgctgaaagataaacacccc
gctatgttgctgttggccgcgacgaaacgtggtaaagcgctggcagcacggttaagtgtg
caactgaatgcggcgctggtgaacgatgccacggcggtggatattgtcgatggtcacatt
tgcgccgaacaccggatgtatggcgggttagcgttcgctcaggaaaagatcaacagcccg
ctggcgatcattacccttgcacccggtgttcaggaaccgtgcaccagtgatacctctcat
cagtgcccgacagaaacggtaccttatgttgctccgcgtcatgaaattctctgtcgcgaa
cgccgtgcgaaagccgcaagcagcgtggacctgagcaaagcaaaacgtgtggttggcgtc
ggtcgtggactggcggcgcaggatgacctaaaaatggtccacgaactggcggcggtgctg
aatgctgaagtcggctgttcacgtccaattgccgaaggcgagaactggatggagcgtgaa
cgttatatcggtgtctccggcgtgttgctgaaatccgatctctacctgacgctggggatc
tccgggcagatccagcatatggttggcggcaacggcgcaaaagtgattgtcgccatcaat
aaagataaaaatgcgccaatcttcaactatgccgactacggtctggtgggcgatatctac
aaagtcgtccctgccctgattagccagttgagccgctaa
              
                            

Download fasta file
RegulonDB