RegulonDB RegulonDB 10.9: Gene Sequence
ydiU gene sequence


Size: 1437        A: 317  T: 361  G: 417  C: 342

Fasta

 

>ydiU E. coli K12. Version NC_000913.3 GI:556503834
atgaccctgtcttttgttacccgctggcgcgatgaattgccagaaacctatacagcactt
tcccctacgcctttaaataatgcccggctgatttggcataataccgaactggctaacacg
ctgagtattccatcgtcgctgtttaaaaatggcgcaggtgtctggggcggcgaagcccta
ctgcctggtatgtcaccactggcgcaggtttacagtggtcatcagttcggcgtctgggcg
ggccaactgggtgatgggcgcggcattttactcggcgaacaactgcttgctgatggcact
acaatggactggcatctgaaaggtgctggcctgacgccttattcgcgaatgggtgatgga
cgggcggttttacgttcgacgatacgagaaagtctcgccagtgaggcgatgcattatctg
ggcattccgacgacccgcgcgttaagtatcgtcaccagcgattcgccagtgtatcgggaa
acggcggagccaggcgcgatgctgatgcgtgtggcaccaagtcatctgcgctttggtcat
ttcgaacatttttactaccgccgcgagtcggaaaaggttcgtcagttagctgactttgct
attcgtcattactggtcacatcttgcagatgatgaggacaaataccgtctctggtttagc
gatgttgtcgcacgtaccgcgtcgttaattgcccaatggcagacggtcggctttgctcat
ggggtgatgaataccgacaacatgtcgctgctggggctgacgcttgattacgggccgttt
ggttttcttgatgattacgaacccggttttatttgtaatcactcggatcatcaagggcgt
tacagctttgataatcaacctgccgtcgcgttgtggaatttacagcgtctggcgcagaca
ttgtcgccatttgttgccgtagatgccctgaatgaggccctggacagctatcagcaggtt
ttgttgacgcattatggagaacggatgcggcagaaactgggcttcatgacggagcaaaaa
gaggataacgcgctactgaatgaattattcagtctgatggcgcgagagcgcagcgattat
acccgcacattccgcatgctgagtctgaccgagcagcacagcgcggcgtcaccgctacgt
gatgagtttattgatcgtgcggcatttgatgactggtttgcccgttatcgggggcgtttg
caacaagacgaggttagcgatagtgagcgtcagcaactgatgcaaagcgttaaccccgct
ctggtattgcgcaactggttggcgcaacgggcgattgaagcggcagaaaagggtgatatg
acggaattgcaccgcctgcatgaggcgttgcgaaatcctttcagcgacagagatgatgac
tatgtcagtcgtccacctgactggggtaaacggctggaagtcagctgctcgagttaa
              
                            

Download fasta file
RegulonDB