RegulonDB RegulonDB 10.10: Gene Sequence
arpB gene sequence


Size: 1900        A: 602  T: 556  G: 333  C: 409

Fasta

 

>arpB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaaaacgatatcattatcagaactcattataagtctcctcatagattgcacatc
gatagcgacataccaacaccttcatcagagcctattaatcaatttgcgcgccagctcatc
accctacttgatacctctgacttaagttcgatgctgtcatactgtgttactcaggaattt
accgcaaactgtcgaaaaatatcacaaaattgttattccactgccctttttaccattaac
tttgccacttcacccatccatacagaaaatatactcattacattacactataaaaaagaa
atcatttccttattactggaaaccacgcctattaaagctaaccatttgcgaagcatactg
gattatattgaacaggaacagttaactgctgaagatcgtaaccattgtatgaaactgtct
aaaaaaatccatagagaaaaaaactatacacccaacagtaaatctcaatggtagtgcatg
ttttttgcaatctccttctgacgctattttttgtcgccatctgtcattgcaatacgccct
tgattcattgagaaatggaaaaggcaaagtcaacctgattaaacattactcctccgttga
atccatacagcagcatgtccccttagtccgggacgcggagttcagagcattacttcgcca
tcctcctgcagggagtcgcgttatcgcgagtaaggattttggcttcgctttagatatttt
cttttgtcgaatgatggcaaacaatgtcagtcatatgtccgcgattttatatatagacaa
tcatactttgtcagtaaggctacgaataaagcagtcagtgtatggacaattaaattatgt
tgtgtccgtttacgacccgaacgataccaacgttgccgtcagagacacccacaggacagc
acggggctttctttcgcttgataagttcatcagttcaggtcccgatgctcagacctgggc
tgatagatatgttcgcaactgtgcaattgctattctgcccctattacctgtgggagttcc
aggggctattttcgcgggtattgcatcacgaatgccatttgcccctatacatccatcggc
aatgttgttaataatggctacaggccagtctcaacagcttattacattattcaaacagtt
gcccatactccctgaaaaagaaatcattgaaataataactgcgcagaatagcgttggtac
acctgctttatttttggctatgatgaacggacatactgacaacgtgaaaatatttatgca
agaaattcagtcactggtagataatcacatcattcatgaagataatctggttaaattact
gcaaactaaaagtgctaacgaaacacctggactttatatctccatgttgtatggattcga
tgaaataatcgatatctttctgaatgcattaaccactccaatagcacaagagcttttaaa
caaaaaactggtgatgagtattttagccatgaaaatacatgatggtgagccaggattata
cgccgcaatggaaaataatcaccctttgtgtgtcacacggttcctctctaaaattaatgg
catcgcctttaaatacaagttgagcaaagctaacatcatggatttattaaaaggagctac
agcacagggaacccctgcattatacatcgccatgagcaagggtaatgaagacgtcgtgtt
atcttatatatcgacgctgggtgcttttgcaaaaaaacattcttttagtcaacatcagtt
atttacactattggccgctaaaaatcatgacaacatgtcagctgttcatatagccattca
tcataagcattataaaactgtagaaacatattatgctgctattaatgcaatcagccaaag
cctgagttttagtgctgatgaaataaagacgtatttataa
              
                            

Download fasta file
RegulonDB