RegulonDB RegulonDB 10.8: Gene Sequence
ydiY gene sequence


Size: 759        A: 188  T: 196  G: 196  C: 179

Fasta

 

>ydiY E. coli K12. Version NC_000913.3 GI:556503834
atgaagcttttgaagacagttcctgccatcgttatgttggcggggggcatgtttgcgtca
ctgaatgcagctgccgatgattccgtttttactgtcatggatgatcctgccagcgctaaa
aaacctttcgaaggtaatctgaacgcaggatatcttgcacaatcaggcaatacgaaaagc
tcctcacttacggctgacaccaccatgacctggtatggacacaccactgcctggtcgctg
tgggggaacgccagtaatacttcttctaatgatgagcgttcttcagaaaaatatgcggcg
ggcgggcgtagccgttttaatttaactgattatgactatttatttggtcaggcaagctgg
ctgacagaccgttataacggctatcgagagcgcgatgtgttgaccgcgggttatggtcgt
cagtttttgaatggcccggtacacagtttccgctttgaattcggtccaggtgtgcgttac
gacaaatataccgacaatgccagtgaaacccagccgctgggctatgcctccggggcttat
gcatggcagttgactgacaacgctaaatttacgcagggtgtttcggtctttggcgcggaa
gacacaacgctgaactccgaaagcgcattaaatgttgctattaatgaacattttggactg
aaggtggcttacaacgtcacatggaactctgaacctccagagtctgcaccggaacatacc
gaccgtcggacaaccttatcgctgggctacagcatgtaa
              
                            

Download fasta file
RegulonDB