RegulonDB RegulonDB 10.9: Gene Sequence
ydiZ gene sequence


Size: 291        A: 94  T: 71  G: 70  C: 56

Fasta

 

>ydiZ E. coli K12. Version NC_000913.3 GI:556503834
atggccagtggcgatcttgtccgttatgtcataaccgtcatgttgcatgaggatacattg
actgaaattaacgagttgaataattacctgactcgcgacggttttttgctcactatgacg
gatgatgagggaaatatccatgagctgggaactaacacttttggacttatcagtacccaa
agtgaagaagaaattagagaactggtttcggggcttacccaaagtgcaaccggcaaagat
cctgaaatcaccatcacgacctgggaggaatggaatagcaacagaaaataa
              
                            

Download fasta file
RegulonDB