RegulonDB RegulonDB 10.9: Gene Sequence
yniA gene sequence


Size: 861        A: 194  T: 220  G: 222  C: 225

Fasta

 

>yniA E. coli K12. Version NC_000913.3 GI:556503834
atgtggcaggcaatcagtcgtcttttgagcgagcagttaggtgaaggcgaaatcgaactg
cgtaatgaactgcctggcggagaagtccatgccgcatggcatttgcgctatgcaggacat
gattttttcgtcaaatgtgatgaaagggaactgcttcccggttttaccgccgaagccgac
caactggagttactgtcgcgtagtaaaaccgtcaccgtgcctaaggtttgggcagttggc
gctgaccgtgactacagttttctggtgatggattatctcccacctcgtccgctggatgcg
catagcgcatttattcttggtcagcaaattgcgcgtttacatcaatggagcgaccaacca
caatttggccttgatttcgataacgcgctctccacaactccacagcccaacacctggcaa
cgtcgctggtcaacgttttttgctgaacaacggattggctggcagttggaactggctgca
gaaaaagggatcgctttcggcaatatcgacgccatcgtcgagcatattcagcagcgtctg
gcctcacatcaaccgcagccttctctgttgcacggcgatttatggtccggcaactgtgca
ctgggtccggatggcccgtacattttcgacccggcctgctactggggtgaccgagagtgc
gacctggcgatgttaccgctgcatactgaacagccgccacaaatctatgacggctatcag
tcagtatccccgctacctgccgatttccttgaacgtcaaccggtttaccaactctacacg
ctgttaaatcgtgcaaggttatttggcggtcagcatttggttattgctcagcagtcattg
gatagattattagcagcatga
              
                            

Download fasta file
RegulonDB