RegulonDB RegulonDB 10.9: Gene Sequence
hxpB gene sequence


Size: 669        A: 160  T: 163  G: 173  C: 173

Fasta

 

>hxpB E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaccccgcgtcagattcttgctgcaatttttgatatggatggattacttatcgac
tcagaacctttatgggatcgagccgaactggatgtgatggcaagcctgggggtggatatc
tcccgtcgtaacgagctgccggacaccttaggtttacgcatcgatatggtggtcgatctt
tggtacgcccggcaaccgtggaatgggccaagccgtcaggaagtagtagaacgggttatt
gcccgtgccatttcactggttgaagagacacgtccattattaccaggcgtgcgcgaagcc
gttgcgttatgcaaagaacaaggtttattggtgggactggcctccgcgtcaccactacat
atgctggaaaaagtgttgaccatgtttgacttacgcgacagtttcgatgccctcgcctcg
gccgaaaaactgccttacagcaagccgcatccgcaagtatatctcgactgcgcagcaaaa
ctgggcgttgaccctctgacctgcgtagcgctggaagattcggtaaatggcatgatcgcc
tctaaagcagcccgcatgcgttccatcgtcgttcctgcgccagaagcgcaaaatgatcca
cgttttgtattagcagacgtcaaactttcatcgctgacagaactcaccgcaaaagacctt
ctcggttaa
              
                            

Download fasta file
RegulonDB