RegulonDB RegulonDB 10.10: Gene Sequence
tcyP gene sequence


Size: 1392        A: 274  T: 388  G: 385  C: 345

Fasta

 

>tcyP E. coli K12. Version NC_000913.3 GI:556503834
atgaactttccattaattgcgaacatcgtggtgttcgttgtactgctgtttgcgctggct
cagacccgccataaacagtggagtctggcgaaaaaagtgctggtgggtctggtgatgggt
gtggtttttggccttgccctgcataccatttatggttctgacagccaggtacttaaagat
tctgtacagtggtttaacatcgttggtaacggctatgttcaactgctgcaaatgatcgtt
atgccgttagtcttcgcctctattctgagcgcggttgcccgtctgcataacgcatctcag
ttaggcaaaatcagttttctgaccatcggtacgcttttgtttaccacgctgattgcggcg
ctggtcggtgtgctggtcaccaacctgtttggtttgacggctgaaggtctggttcagggt
ggtgcagaaactgcacgtctgaacgccattgaaagtaactatgttggtaaagtctctgat
ctgagcgttccgcagctggtcttgtcctttatcccgaaaaacccgtttgccgatcttacc
ggagccaatccgacgtcaattatcagcgtggtaatttttgccgcattcctcggcgtagct
gcattgaaactgctgaaggatgatgcgccgaaaggtgaacgcgtcttagccgctatcgat
accctacaaagctgggtgatgaaactggttcgcctggtcatgcagttgaccccttacggc
gttctggctctaatgaccaaagtggttgcaggttctaacttgcaagacatcatcaaactg
ggaagtttcgttgtcgcgtcctacctcggtctgctgattatgtttgcagtgcatggcatt
ctgctgggcattaatggcgtgagtccgctgaagtacttccgtaaggtatggcctgtgctg
acgtttgcctttaccagccgttccagtgctgcgtctatcccactgaatgtggaagcacaa
acgcgtcgtctgggcgttcctgaatccatcgccagtttcgccgcctctttcggtgcaacc
attggtcagaacggctgcgccggtttgtatccggcaatgctggcggtgatggttgcgcct
acggttggcattaacccgctggacccgatgtggattgcgacgctggtcggtattgttacc
gttagttccgcaggcgttgccggtgtcggtggtggtgcaactttcgccgcactgattgta
ctgcctgcgatgggcctgccagtaaccctggtggcgctgttaatctccgttgaaccgctt
atcgacatgggccgtacggcgttaaacgttagtggctcgatgacagctggcacgctgacc
agccagtggctgaagcaaaccgataaagccattctggatagcgaagacgacgccgaactg
gcacaccattaa
              
                            

Download fasta file
RegulonDB