RegulonDB RegulonDB 10.8: Gene Sequence
ydjO gene sequence


Size: 804        A: 266  T: 256  G: 149  C: 133

Fasta

 

>ydjO E. coli K12. Version NC_000913.3 GI:556503834
atgttttctacaaacttaatacagagtaattatggtgatttaaatattaaaagcctggct
ttcgactcttttaaagaaaggctgcagtctactatgacagcactcactttctttatatca
acgggtcaatgtgactgcgatgaaatagcagaatcaaactttaattatatgattgcctat
atgtctaacattaactatgatgcctcaaagccaggagcgccagcacttagttttgataca
tatctgcaggacaatgttaaatatagagtaataattaataatctttatggtagtgaaatt
cggataagaggtataaataaagattttattggaatggatgtcacttctgtatttcgccca
gaaaaaatgaccaatttgatcagtataaaaaacaggttggttattcactatttaaggact
atatactatgaacaaaattatatacatcctgtcgggagcatttttgctgcgattcaaaaa
aatgagagtctcctaaagtttccttcgataatatcaatgcttaatatcaatcttcttttt
aatccactaaatcttccgggaatgggaagtggtgtgcttgaagatattatgagtattcca
gatagttcacttagaaaacgtctcgggtatgaggttttaagcttctcgctacaggcacat
tcattgagccaggaatgtattgataagttggacatttttttcgctgacgatctgtttaaa
tatgagtcagtatgcatcgccgcgatggaacatttaaaaagtaaggcaacggcccctata
caaaacggaccgttgccagcataa
              
                            

Download fasta file
RegulonDB