RegulonDB RegulonDB 10.9: Gene Sequence
cedA gene sequence


Size: 243        A: 61  T: 55  G: 67  C: 60

Fasta

 

>cedA E. coli K12. Version NC_000913.3 GI:556503834
atgaagaaaccgctccgccagcaaaaccgccagattattagctatgtcccacgcacggaa
cccgcgccgccagaacatgcgataaagatggattcgtttcgtgatgtctggatgctgcgt
ggcaaatatgttgcgtttgtactgatgggagagtcatttctgcgctcaccggcgtttact
gtgcctgaatctgcccaacgttgggcaaatcagatccgccaggaaggggaagtgactgag
taa
              
                            

Download fasta file
RegulonDB