RegulonDB RegulonDB 10.10: Gene Sequence
cho gene sequence


Size: 888        A: 211  T: 219  G: 237  C: 221

Fasta

 

>cho E. coli K12. Version NC_000913.3 GI:556503834
gtggtacggcgtttaacttctccgcggctcgaatttgaagctgcggcaatttatgaatat
cccgaacatttacgttcattccttaatgacttacccacccgaccaggggtgtatctgttt
catggtgaaagtgacaccatgccgctctatatcggcaaaagcgttaacatccgcagccgc
gtcctttctcatttacgtaccccggatgaagccgccatgctacggcaatcccgacggatc
agctggatatgtaccgccggtgaaatcggcgctctgctccttgaagcgcgattaatcaaa
gaacaacagccgctgtttaataaacggttgcgccgcaatcgccagctctgtgccctgcaa
ttaaatgaaaagcgcgtcgatgtggtgtatgccaaagaggtggatttttcacgagccccc
aacctgtttggcctgtttgccaataggcgcgcagctttgcaagcattgcagaccatcgct
gatgaacaaaaactttgttatggcctgctgggactggaaccgttaagtcgcggtcgtgca
tgttttcgttcagcgctaaaacgttgcgccggagcatgctgcggtaaagagagccatgag
gaacatgcgctacgcttgcgccagtctctggagcgtttgcgggtggtgtgttggccttgg
caaggggcggtggcgctgaaagaacagcacccggaaatgactcaatatcatattattcaa
aactggctgtggctgggggcggttaattcgctggaagaagcgacaacgttaattcggaca
cccgccgggtttgatcacgacggttataaaattctttgtaagccgctgctttccggtaac
tatgaaattactgaacttgatccggcgaatgaccagcgagccagttga
              
                            

Download fasta file
RegulonDB