RegulonDB RegulonDB 10.9: Gene Sequence
ves gene sequence


Size: 576        A: 136  T: 141  G: 166  C: 133

Fasta

 

>ves E. coli K12. Version NC_000913.3 GI:556503834
atggaatactttgatatgcgtaaaatgtcggtgaatctgtggcgaaatgctgccggtgaa
acgcgcgaaatttgcacgttcccaccggcaaaacgtgatttttactggcgtgccagcatt
gcatccatcgcggcgaatggggagttttctttgtttcccggcatggaaaggatagtgacg
ttgctggaaggcggcgagatgctccttgaaagcgcagaccgctttaaccataccttaaaa
ccgttccagccttttgcctttgcagcggaccaggtggtaaaagcgaaactgacggcaggg
cagatgtcgatggatttcaacatcatgacacgcctggatgtctgtaaggcgaaagtcaga
attgccgaacgtacgtttactacctttggctcacgcggcggggtggtgtttgtgattaac
ggggcgtggcaactgggcgataaattgctcactaccgaccagggcgcgtgctggttcgat
ggcaggcacaccctgcggcttttacaaccgcaaggtaaactgttgttcagtgaaatcaac
tggctcgctggtcattcgccggatcaagttcagtaa
              
                            

Download fasta file
RegulonDB