RegulonDB RegulonDB 10.9: Gene Sequence
spy gene sequence


Size: 486        A: 158  T: 81  G: 116  C: 131

Fasta

 

>spy E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaaattaactgcactgtttgttgcctctaccctggctcttggcgcggctaacctg
gcccatgccgcagacaccactaccgcagcaccggctgacgcgaagccgatgatgcaccac
aaaggcaagttcggtccgcatcaggacatgatgttcaaagacctgaacctgaccgacgcg
cagaaacagcagatccgcgaaatcatgaaaggccagcgtgaccagatgaaacgtccgccg
ctggaagaacgccgcgcaatgcatgacatcattgccagcgataccttcgataaagtaaaa
gctgaagcgcagatcgcaaaaatggaagaacagcgcaaagctaacatgctggcgcacatg
gaaacccagaacaaaatttacaacatcctgacgccggaacagaaaaagcaatttaatgct
aattttgagaagcgtctgacagaacgtccagcggcaaaaggtaaaatgcctgcaactgct
gaataa
              
                            

Download fasta file
RegulonDB