RegulonDB RegulonDB 10.9: Gene Sequence
astB gene sequence


Size: 1344        A: 292  T: 305  G: 402  C: 345

Fasta

 

>astB E. coli K12. Version NC_000913.3 GI:556503834
atgaacgcctgggaagtcaatttcgacgggctggtagggctgacgcatcattacgcgggc
ctgtcgtttggtaatgaagcctctacccgtcaccgttttcaggtgtctaacccgcgactg
gcggcgaagcagggcttactgaaaatgaaagcccttgccgatgcgggattcccccaggcc
gtgatcccgccgcacgagcgtccgtttattccggtgctgcgtcagttgggattcagtggt
agcgatgagcaggtactggaaaaagttgcacgccaggcaccgcactggctttccagcgtc
agttccgcttcgccaatgtgggtagccaatgcggcaacgatcgcgccatctgccgatacg
ctggatggcaaagtgcatctcaccgttgccaacctgaacaataaatttcaccgttcgctg
gaagcgcccgtcactgaatcgctgttaaaagcgatttttaacgacgaagagaaatttagc
gtccattcggcgttgccacaggtagcgttgctcggtgatgagggggcggcaaaccacaat
cgtctcggcggtcattacggtgaaccgggtatgcaactttttgtctacgggcgagaagaa
ggcaatgatacccggccttcccgttatccggcgcgacagactcgcgaagccagcgaggcg
gtggcaaggctgaatcaggtgaatccccaacaggtgattttcgcccagcaaaacccggac
gttatcgaccagggcgtttttcataatgacgtgattgccgtgagtaaccgccaggtgctg
ttttgccaccaacaggcgttcgctcgccagtcacagttactggcaaacctgcgtgcgcgg
gtcaatggttttatggcgatagaagttccggcaactcaggtttccgtgtctgatacggtg
tctacctatctgtttaacagccaactgctgagccgcgatgatggttccatgatgttggtg
ctgcctcaggagtgtcgggaacacgccggagtatggggttatctcaatgaactccttgcc
gctgacaacccgattagcgaactaaaagtctttgatttacgtgaaagcatggcgaatggc
ggcggcccggcgtgcctgcggttgcgggtggtattgacagaagaagaacgccgggcggtg
aatccggcggtgatgatgaacgatacgctgtttaatgcgctcaatgactgggtggatcgt
tactaccgcgatcgccttactgctgccgatctggccgacccgcaattgctgcgcgaaggg
cgggaagcactggatgtattgagccaattactgaatctcggttcggtttatccgttccag
cgcgagggagggggcaatggataa
              
                            

Download fasta file
RegulonDB