RegulonDB RegulonDB 10.9: Gene Sequence
astD gene sequence


Size: 1479        A: 296  T: 324  G: 474  C: 385

Fasta

 

>astD E. coli K12. Version NC_000913.3 GI:556503834
atgactttatggattaacggtgactggataacgggccagggcgcatcgcgtgtgaagcgt
aatccggtatcgggcgaggtgttatggcaaggcaatgatgccgatgccgctcaggtcgag
caggcttgtcgggcagcccgtgcggcgtttccgcgctgggcgcggctttcatttgctgaa
cgtcatgccgttgtcgaacgctttgccgcactgctggaaagcaataaagccgaattaacc
gcgattattgccagagaaacgggtaagccgcgctgggaagcggcaaccgaagtgacggcg
atgatcaataaaatcgcgatatcaattaaggcgtatcacgttcgtaccggcgagcagcgt
agtgaaatgccggacggcgcggcgagcctgcgacatcgcccgcacggcgtgctggcggtg
tttgggccgtataatttccctggtcatttgccgaacggacatatcgttccggcattgctg
gcaggtaacaccattatctttaaacccagcgaactgacaccgtggagtggcgaagcggta
atgcgtttatggcagcaggctggcttgccgccaggcgtgctgaacctggtgcagggcggg
cgtgaaacgggtcaggcgctgagtgcgctggaggatctcgacggtttgctgtttaccggt
agcgccaatacaggctaccagttgcatcgccagctctccggtcagccggagaaaattctc
gcccttgagatgggcggtaataatccgctaattatcgatgaggtggcggatatcgacgcg
gctgtccatctgaccattcagtcggcgtttgtcacagccggtcaacgctgcacctgcgcc
cgccgtttattgctgaaaagcggggcgcagggcgatgcgtttcttgctcgtctggttgcc
gtcagccagcgattaacgccgggcaactgggatgacgaaccgcagccgtttattggcggg
ctgatttctgaacaggccgcacagcaggtggttactgcatggcagcaactggaagcgatg
ggcggacgacccctgcttgcgccgcgcttattacaagcagggacatcgttgctgacgccg
gggatcattgaaatgacaggcgttgctggcgtaccagatgaagaggtgttcggaccgtta
ttgcgcgtctggcgttatgatactttcgatgaagcgattcgaatggcgaataacactcgc
ttcggactctcttgcggtctggtttcccccgagcgggaaaagttcgatcaactgttgctg
gaggcgcgggcggggattgttaactggaacaaaccgcttaccggtgctgccagtaccgcg
ccattcggcggcattggtgcttccggtaaccatcgccccagcgcctggtatgccgcagat
tactgcgcatggccgatggcgagcctggagtcggactcgttaacattgcccgccacgctt
aaccccgggctggatttttccgatgaggtggtgcgatga
              
                            

Download fasta file
RegulonDB