RegulonDB RegulonDB 10.9: Gene Sequence
astA gene sequence


Size: 1035        A: 227  T: 228  G: 303  C: 277

Fasta

 

>astA E. coli K12. Version NC_000913.3 GI:556503834
atgatggtcatccgtcccgttgagcgatcagatgtctcggcgctgatgcagcttgccagc
aaaacgggcggcggcctgacgtcgcttcccgccaatgaagccacgctttcggcgcgtatc
gaaagggcaatcaaaacctggcaaggcgaactgcccaaaagtgagcagggctatgtgttc
gtgctggaagatagcgagacaggcaccgtggcggggatttgtgccattgaggtggcggtt
gggctgaacgatccctggtacaactatcgcgtcggcacgttggttcacgcctcaaaagag
ctgaatgtctataacgcattgccgacgctgtttctcagtaacgatcacaccggcagcagc
gagctgtgcacgctgtttctcgacccggactggcgcaaagagggcaacggctatttgctg
tcgaaatcgcgctttatgtttatggcggcttttcgcgacaagtttaatgacaaagtggtt
gctgaaatgcgcggggtgattgacgaacacggctattcaccgttctggcaaagcctcggt
aaacgcttcttttcgatggattttagccgcgccgattttctctgcggcaccgggcaaaag
gcatttattgcagaactgatgccgaaacatccgatctatacccactttttatcccaggaa
gcccaggacgtcatcggtcaggtacatccgcaaaccgcgcctgcccgcgcggtgctggag
aaagaaggttttcgctaccgtaactatatcgacatctttgacggtgggccgacgcttgag
tgtgacatcgaccgcgtgcgcgccatccgtaaaagtcggctggtggaagtggcagaaggg
cagcctgcgcagggcgatttcccagcctgcctggtcgccaatgaaaattatcaccatttc
cgcgtggtgctggtgcgtaccgatccggcaaccgagcgtttgattttaaccgccgcacaa
ctggatgccctcaaatgccacgccggggatcgcgttcgtctggtgcgcctgtgcgcagag
gagaaaacagcatga
              
                            

Download fasta file
RegulonDB