RegulonDB RegulonDB 10.9: Gene Sequence
astC gene sequence


Size: 1221        A: 265  T: 284  G: 368  C: 304

Fasta

 

>astC E. coli K12. Version NC_000913.3 GI:556503834
atgtctcagccaattacgcgtgaaaactttgatgaatggatgatacctgtttacgctccg
gcaccctttataccggtacgtggcgaaggttcgcgcttgtgggatcagcaggggaaagag
tatatcgacttcgcgggtggcattgcggtgaacgcgctgggccatgcgcatccggaactg
cgtgaagcgctgaacgaacaggcgagtaagttctggcataccggcaacggttacaccaac
gagccggtactgcgactggcgaaaaaattgatcgacgccacgtttgccgatcgcgtcttc
ttttgtaactccggtgcggaagccaacgaagcggcgctaaaactggcgcgtaaattcgct
cacgaccgctacggcagccataagagcggcatcgtggcgttcaaaaatgcgtttcatggt
cgcacgctgtttactgtcagtgcgggtgggcagccagcctattcacaggattttgcgcca
ctgccggcggatattcgtcatgctgcatataacgatattaactctgccagcgcgctgatt
gacgactctacctgtgcggtgattgtcgaacccatccagggggaaggcggtgtggtgcca
gccagcaacgcgtttttacaaggtctgcgtgaattgtgtaaccgccacaatgcgctgttg
atttttgatgaagtacaaaccggcgtcgggcgcaccggggaactgtatgcctatatgcac
tacggcgtgacgcctgatctgttaactaccgccaaagcgctgggcggcggtttcccggtc
ggtgcgttgttggcaaccgaagagtgcgcccgcgtgatgaccgttggcactcatggcacc
acctatggcggtaatccgctggcctcggcggtggcaggcaaagtgctggagctcatcaac
acaccagagatgcttaatggcgttaaacagcgtcacgactggtttgttgagcgtcttaat
actattaatcaccgctatggtttgttcagtgaagttcgcggcttaggtttgctgattggc
tgtgtactgaatgccgattacgccgggcaagcgaaacagatctctcaggaagcggcgaaa
gcaggcgtgatggtactgattgcgggtggcaacgtggtgcgttttgcgcctgcgctcaat
gtcagcgaagaagaggtgacgaccggactggatcgctttgcagctgcttgcgaacacttt
gttagccgaggttcatcatga
              
                            

Download fasta file
RegulonDB