RegulonDB RegulonDB 10.9: Gene Sequence
ydjY gene sequence


Size: 678        A: 195  T: 155  G: 184  C: 144

Fasta

 

>ydjY E. coli K12. Version NC_000913.3 GI:556503834
atgttgcaacattattcagtgtcatggaaaaaaggactggctgcactctgtttactggct
gttgctgggcttagcggctgcgatcaacaagagaatgcggcggcaaaagtggaatacgac
ggactttcgaacagccaaccgctgcgtgtcgatgccaataaccatacggtaaccatgctg
gtgcaaattaatggtcgtttcctcaccgacgacactcgtcacggtattgtgtttaaagat
ggctccaacggacataaatcgctgtttatgggttatgcgaccccgaaagcattttatgaa
gccctgaaagaggcaggtggtacgccgggcgaaaacatgacgatggataataaagaaacg
actcatgtcacaggcagcaaactggatatttcggtcaactggcaaggggcggcaaaagcg
tattccttcgatgaagtgattgttgacagtaatggcaagaaactggacatgcgctttggc
ggtaatttaacggcagcagaagagaagaaaacgggttgcctggtgtgtctggatagctgc
ccggtcggcatcgtcagcaatgcaacatacacttatggtgcggttgaaaaacgtggtgaa
gttaaattcaaaggcaatgcctcagttctcccggcggataacacgctggcaacggttacc
tttaaaatcgccgaataa
              
                            

Download fasta file
RegulonDB