RegulonDB RegulonDB 10.10: Gene Sequence
ydjZ gene sequence


Size: 708        A: 127  T: 216  G: 191  C: 174

Fasta

 

>ydjZ E. coli K12. Version NC_000913.3 GI:556503834
atgatgatgatgcaatcgcgaaaaatctggtactaccgtataaccctcatcatcctgttg
ttcgctatgctgctggcatgggcgctgcttcccggcgtccatgagtttatcaatcgcagc
gttgcggcgtttgccgccgtggaccaacagggtatagaacgctttattcagtcttacggc
gcactggcggcagttgtctcgttcttgttgatgattttgcaggccattgctgcaccgcta
cctgcgtttttgatcacctttgccaatgcgtcgctgtttggcgcgttctggggcggcttg
ctgtcgtggaccagttcgatggccggcgcggcgctgtgcttttttatcgccagagtgatg
ggccgcgaagtggtggaaaaattaaccggcaaaaccgtgcttgacagtatggacggcttt
ttcactcgctacggcaaacacaccattctggtctgtcggttattgccttttgtccctttc
gatccaatcagctatgctgccggtttgacttcaatacgttttcgctcgttttttatcgcc
accgggcttggtcagttaccggcaactattgtttattcctgggcgggcagcatgttaaca
ggcggtactttctggtttgtcaccggactgtttattctgtttgccctgaccgtggtgatt
tttatggcgaagaaaatatggcttgaacgccagaagaggaatgcctga
              
                            

Download fasta file
RegulonDB