RegulonDB RegulonDB 10.9: Gene Sequence
ynjE gene sequence


Size: 1308        A: 339  T: 269  G: 359  C: 341

Fasta

 

>ynjE E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgtgtttctcaaatgaccgcgctggcaatggctttagggctggcttgcgcttct
tcgtgggccgctgaactggcgaagcctcttacacttgaccagcttcaacaacaaaatggc
aaagcgatagatactcgccccagcgcgttttataacggctggccacaaaccttaaatggc
ccttctggtcatgaacttgccgccttaaacctctctgccagctggcttgacaaaatgagc
accgaacagctcaacgcgtggatcaagcaacataacctgaaaaccgatgctccggtggcg
ctgtacggtaatgacaaagatgtcgacgccgtcaaaacgcgactgcaaaaagcaggttta
acgcatatctccatcctgagtgacgcgctaagcgaaccttcccgtctgcaaaaactgccg
cattttgagcagctggtttatccgcaatggctgcacgacctgcaacaaggtaaagaggtt
acggcgaaacctgccggtgactggaaagtcattgaagcggcctggggcgctcctaagctt
taccttatcagccatattcccggcgctgactacatcgataccaacgaagtggaaagtgaa
ccgctgtggaacaaagtttctgatgaacaactaaaagcgatgctggcaaaacacggcatt
cgccatgacaccacggtcattctgtatgggcgtgacgtatacgctgcagcgcgtgtggcg
cagattatgctttatgctggcgtgaaagatgtgcgcctgctggatggcggctggcaaacc
tggtccgacgcgggactgcctgttgagcgcggaacgccaccgaaagtgaaagcggaaccg
gatttcggcgtgaagatcccggcacaaccgcagttgatgctcgatatggaacaggcccgt
ggactgctgcatcgccaggatgcatcgctggtgagcattcgttcgtggccagaatttatc
ggtacgaccagcggttacagctatattaaaccaaaaggtgaaatagccggcgcacgttgg
ggacacgctggtagcgactcgacgcatatggaagattttcataacccggatggcaccatg
cgcagcgccgatgatattaccgctatgtggaaagcgtggaatatcaaaccagagcagcaa
gtttcattctactgcggcaccggctggcgcgcgtccgaaacctttatgtacgcacgcgcc
atgggttggaagaatgtttccgtgtatgacggcggctggtacgaatggagcagcgatcca
aaaaatccggtagcaaccggtgaacgcggcccggacagtagcaaataa
              
                            

Download fasta file
RegulonDB