RegulonDB RegulonDB 10.9: Gene Sequence
ynjF gene sequence


Size: 621        A: 101  T: 188  G: 189  C: 143

Fasta

 

>ynjF E. coli K12. Version NC_000913.3 GI:556503834
gtgctagaccgccatcttcatccccggattaaaccgttgttgcatcagtgcgtgcgggtt
cttgataaaccgggcattacgccagatggtttaacattagtgggatttgccatcggcgtg
ctggctctgccgtttctggcgctgggctggtatctggcggcgctagtcgtcattttgttg
aacaggctgcttgatggtctggacggtgcgctggcgcggcgcagagagcttaccgacgcg
ggcggctttcttgatatttctctcgattttctcttttacgcgctggtgccgtttggcttt
attcttgctgcaccggagcaaaatgcgctggcaggcggctggttgttgtttgcgtttatc
ggcacgggcagcagttttctcgcctttgctgcactggcagcaaaacatcagattgataac
cccggttatgcacataagtcgttttactatctggggggattaaccgaaggcacagaaacg
atcttactgtttgtgctgggatgtttattccctgcatggtttgcgtggtttgcgtggatc
ttcggtgcgttgtgctggatgacgacctttacgcgggtgtggagtgggtatctgacgctg
aagtcgctccagcgtcagtaa
              
                            

Download fasta file
RegulonDB