RegulonDB RegulonDB 10.9: Gene Sequence
nudG gene sequence


Size: 408        A: 94  T: 90  G: 123  C: 101

Fasta

 

>nudG E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatgattgaagttgttgccgccatcattgaacgtgatggcaaaattttactcgcg
caacgccccgcccagagcgatcaggcgggattatgggagtttgccggtggtaaagtcgag
ccggatgaaagtcagcggcaggcgctggtgcgtgagttacgcgaagaactgggcatcgaa
gcaactgtgggtgaatatgttgccagccatcagcgagaagtttcggggcggattatccat
cttcatgcctggcacgtacccgacttccacgggacgttacaggcacatgaacatcaggcg
ctggtctggtgctcacctgaagaggcgctgcaatatccgctggcccctgctgacattcca
ttattagaggcgtttatggctttacgcgccgccagaccagcggattag
              
                            

Download fasta file
RegulonDB