RegulonDB RegulonDB 10.9: Gene Sequence
ynjI gene sequence


Size: 1041        A: 311  T: 300  G: 241  C: 189

Fasta

 

>ynjI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagttttattacaaaaccatcctgggagcgagaagtattcttttaatggctgg
gaaatatttaatagtaattttgaacggatgattaaagaaaataaggccatgctgctttgt
aagtgggggttttatttaacatgtgttgtcgctgtaatgtttgtgttcgcagcgataaca
tccaacggtttgaatgaaagaggcctgattaccgcgggatgctcttttctttatctatta
attatgatggggcttattgttcgggccggttttaaagcaaaaaaagaacaactgcattat
tatcaggctaaaggtattgagccgctcagtatcgagaagttacaggcgctacaattgatc
gcaccttatcgattctatcataagcaatggtctgaaacgctggagttctggccgcgaaag
cctgaacctggcaaagataccttccaatatcatgtgcttccttttgactcgatcgatatc
ataagtaaaagacgcgagtctttagaggatcaatggggtatcgaagatagcgaaagttat
tgtgccttaatggagcattttctttctggcgaccatggagccaatacctttaaagcaaac
atggaggaagccccagagcaggttatcgccttgttgaataaatttgctgtttttccctca
gactatatctctgattgcgctaatcatagctccggtaaatcctcggcgaagctaatatgg
gcggcggaattatcatggatgatctcgatatcaagcacagcttttcaaaacgggacaatt
gaagaagaactggcctggcattatataatgcttgcttctcgaaaggcgcacgagttgttc
gaaagcgaagaagattatcaaaaaaatagtcaaatgggatttctttactggcatatctgc
tgctatcgcagaaagttaacggatgctgaacttgaagcgtgttatcgttacgacaagcag
ttttgggagcactacagtaagaaatgccgttggcccataagaaatgttccgtggggagca
tcatccgttaaatactcataa
              
                            

Download fasta file
RegulonDB