RegulonDB RegulonDB 11.0: Gene Sequence
ydjF gene sequence


Size: 759        A: 239  T: 199  G: 181  C: 140

Fasta

 

>ydjF E. coli K12. Version NC_000913.3 GI:556503834
gtggcggcaaaagacaggattcaggcaattaagcaaatggttgccaacgataaaaaggtg
acagtctcaaatttgagtgggatttttcaggtaaccgaagaaaccattcgccgcgatctt
gagaagctggaagatgaaggctttttgaccagaacctatggtggtgctgttttaaataca
gcgatgttgacggagaatatccatttttataagcgcgcttcatcgttttatgaagagaag
cagcttattgcacgcaaggcactaccctttatcgacaataaaaccaccatggcagccgat
tccagtagtaccgtaatggaattgctcaaattgttacaggaccgtagtggcctgacgttg
ctaaccaactcggcggaagcgattcatgttctggctcagtcagaaattaaagtcgtttca
acgggtggggaactaaacaaaaatacactttcactgcaaggaagaattactaaagagatc
atcaggcgctatcatgtcgatatcatggtaatgagttgtaaaggtcttgatattaacagc
ggcgcgctggactctaatgaagcggaagctgaaatcaaaaagacaatgatccgtcaggcg
acagaagttgcgttattggttgatcactctaagtttgatcgcaaagcttttgtccagtta
gctgattttagtcatattaattacataataactgataaatcaccgggtgcagagtggata
gcattttgcaaagacaataatatccagctggtgtggtaa
              
                            

Download fasta file
RegulonDB