RegulonDB RegulonDB 10.9: Gene Sequence
yeaE gene sequence


Size: 855        A: 222  T: 201  G: 239  C: 193

Fasta

 

>yeaE E. coli K12. Version NC_000913.3 GI:556503834
atgcaacaaaaaatgattcaatttagtggcgatgtctcactgccagccgtagggcaggga
acatggtatatgggcgaagatgccagtcagcgcaaaacagaagttgctgcactacgcgcg
ggcattgaactcggtttaaccctcattgataccgccgaaatgtatgccgatggcggtgcc
gaaaaggtggttggggaagcattaaccggtctgcgagagaaggtctttctcgtctctaaa
gtctatccgtggaatgctggcgggcaaaaagcgataaatgcatgcgaagccagtttacgc
cgtctcaatactgattatctcgatctttacttattacactggtctggcagtttcgctttt
gaagagactgtcgcagcgatggaaaaattgatcgcccagggaaaaatccgccgctggggc
gtttctaaccttgattatgctgatatgcaggaactctggcagctgccggggggaaatcag
tgtgccactaatcaggtgctttaccatctcggttcacgaggaattgagtacgatctactc
ccctggtgccagcaacagcagatgccggtgatggcttacagtccgttagcccaggccggg
cggttgcgcaatggactgttaaaaaacgcggtagtcaacgaaattgcacatgctcacaat
atcagcgcggcacaagtattgttggcgtgggtgatcagtcatcagggtgtgatggcgatt
ccaaaagcggccacgattgcccatgtccaacaaaatgcggctgtgcttgaggtcgaactt
tcttcagcggaattagctatgctggataaggcatatccggcaccaaaaggaaaaactgcg
ctggatatggtgtga
              
                            

Download fasta file
RegulonDB