RegulonDB RegulonDB 10.9: Gene Sequence
mipA gene sequence


Size: 747        A: 179  T: 178  G: 195  C: 195

Fasta

 

>mipA E. coli K12. Version NC_000913.3 GI:556503834
gtgaccaaactcaaacttctggcacttggagtgcttatcgcaacgtctgcaggcgtagcg
cacgctgaaggtaaattttccctgggcgcaggcgtaggtgtcgttgaacacccatataaa
gattacgataccgatgtttacccagtaccggtaatcaactatgaaggcgataacttctgg
ttccgtggcttaggtggtggttactacctgtggaatgacgcaacggataaactttcaatt
accgcttactggtcgccgctttacttcaaagcgaaagacagtggcgatcaccaaatgcgt
cacctggatgaccgtaagagcaccatgatggctggtctgtcttatgctcactttacccag
tacggttacctgcgtaccaccctggctggcgataccctggataacagcaacggcatcgtc
tgggatatggcctggttgtatcgttacaccaacggtggcctgaccgtgactccgggtatt
ggtgtgcagtggaacagcgaaaaccagaacgaatactattatggcgtatcgcgcaaagag
tccgctcgcagcggtctgcgtggctataacccgaacgacagctggagcccttacctggag
ctgagcgccagctacaacttcctcggcgactggagtgtttacggtaccgcacgctacacc
cgtctgtctgatgaagttactgacagcccgatggtggataaatcctggactggcctgatt
tctaccgggatcacctacaaattctga
              
                            

Download fasta file
RegulonDB