RegulonDB RegulonDB 10.9: Gene Sequence
yeaG gene sequence


Size: 1935        A: 513  T: 452  G: 492  C: 478

Fasta

 

>yeaG E. coli K12. Version NC_000913.3 GI:556503834
atgaatatattcgatcactatcgccagcgatatgaagctgccaaggacgaagagttcaca
ctgcaggagtttcttaccacttgtcggcaagatcgcagtgcttatgccaacgcggctgag
cggctattgatggctatcggtgagcctgtcatggtcgatacagcccaggaacccagactt
tctcgactcttttctaaccgggtcattgcacgttatccggcgtttgaagagttttacggc
atggaagacgcgattgaacagattgtctcttatctgaaacacgcggctcaggggctggaa
gagaagaaacaaatcctgtatctgctggggcctgtgggtgggggtaaatcatcgcttgct
gagcgactgaaatcattaatgcagctcgtaccgatttatgtattgagcgcgaacggtgag
cgtagcccggtcaacgatcatccgttctgtcttttcaatccgcaggaagatgcgcagatt
ctggaaaaagagtatggcattcctcgccgttatctcggcaccatcatgtcgccgtgggcg
gcaaaacgcctgcatgaatttggtggcgatatcactaagttccgggtagtgaaggtctgg
ccgtcaattctgcaacaaattgctatcgccaaaacggaacccggcgatgagaacaaccag
gacatctccgcgctggttgggaaagtcgatattcgtaaactcgaacactacgcgcagaat
gacccggacgcctacggctattccggtgcgctgtgccgcgccaatcaggggatcatggaa
ttcgttgagatgtttaaagcaccgattaaagtgctgcatcccttgttaaccgccactcag
gaaggtaactacaacgggacggaaggtatctccgccctgccgttcaacgggattattctc
gcacactcgaacgagtccgaatgggtcactttccgtaataacaaaaacaacgaagccttc
ctcgatcgtgtttacatcgtgaaggtgccgtattgcttgcgcatttccgaagagatcaaa
atctacgagaaattgcttaatcacagtgaattgactcacgccccatgcgcccctggcacg
ctcgaaacactgtcacgtttttccattctttcgcgcctgaaagagccagaaaactccagc
atttattcaaagatgcgggtttatgatggcgaaagtctgaaagacaccgatcccaaagcc
aagtcgtatcaggaatatcgtgactacgccggtgtcgatgaagggatgaacggtctgtcg
acgcgttttgcgtttaagatcctctcccgcgtgttcaacttcgatcatgtagaagtggca
gcaaacccggtccatctgttctacgtcctggaacagcagattgagcgcgagcagttccca
caagagcaggcagaacgctatctggagttcctgaaaggttatctgatcccgaaatatgcc
gagtttatcggcaaagagatccagacggcctaccttgaatcctattccgaatatgggcaa
aacattttcgaccgttatgttacctacgcggatttctggattcaggatcaggagtatcgc
gatccggataccgggcagctgtttgaccgcgagtctcttaacgccgagctggagaaaatc
gagaaaccggcggggatcagtaatccaaaagatttccgcaacgagattgttaacttcgta
ctgcgcgccagagcgaataacagcggacgcaatccgaactggaccagctatgaaaaactg
cgcacggtcatcgagaagaaaatgttctccaataccgaggagctgttgccggttatctcg
tttaacgccaaaacgtcaaccgacgagcagaagaaacacgacgactttgtcgaccgtatg
atggaaaaaggctacacccgtaaacaggtgcgtttactgtgcgaatggtatttgcgcgta
cgtaaatcgtcttaa
              
                            

Download fasta file
RegulonDB