RegulonDB RegulonDB 10.9: Gene Sequence
yeaH gene sequence


Size: 1284        A: 352  T: 301  G: 321  C: 310

Fasta

 

>yeaH E. coli K12. Version NC_000913.3 GI:556503834
atgacctggtttattgaccggcgtctgaacggcaaaaacaaaagcatggtgaatcgccag
cgttttttacgccgttataaagcgcaaattaaacagtcgatctccgaggccattaataag
cgttcggtgactgacgtcgacagcggcgaatccgtatccattcccacggaagatattagc
gaaccgatgtttcatcaggggcgtggcggtctgcgccaccgcgtgcatccgggcaatgac
catttcgtccagaacgaccgaattgaacgtccccagggtggcggcggaggttccggcagt
ggtcagggccaggccagccaggatggtgaaggtcaggatgaatttgtctttcagatttcg
aaagatgagtatcttgatctgctctttgaagatttggccttaccgaatctgaaacaaaac
caacaacgccagctgaccgaatataaaacgcatcgggcgggttataccgctaacggcgtt
ccggccaatatcagcgttgtgcgttcattgcagaactcactggcgcgacgcacagccatg
acggcaggcaagcggcgggaacttcatgcactggaagagaatttggccatcatcagcaac
agtgaacctgcgcaactgctggaagaggaacgtctgcgcaaagaaattgcagaattacgt
gccaaaattgaacgcgtcccttttattgacaccttcgatttacgttacaagaactacgag
aagcggcccgatccctccagccaggcagtgatgttttgcctgatggacgtttccggttca
atggatcaatccactaaagatatggctaagcgtttttatattctgctgtatctgttcctc
agcagaacgtataagaacgtggaagtcgtatacatccgccatcatacccaggcgaaagaa
gtcgatgaacatgagtttttctactcgcaggaaacaggcggcaccattgtttccagcgcc
ctgaaactgatggatgaggtagtgaaagagcgttataacccggcacagtggaatatttac
gctgcacaagcatcggacggcgataactgggccgatgactctccgctttgccatgaaatc
ctggcgaaaaaattattacctgttgttcgttattacagctatatcgaaattacccgtcgt
gcacatcagacattgtggcgagaatatgagcatctgcaatctactttcgacaactttgcg
atgcagcacatccgcgaccaggatgatatttatccggtgttccgtgaactgtttcataaa
caaaatgcaacagctaaaggctaa
              
                            

Download fasta file
RegulonDB