RegulonDB RegulonDB 10.9: Gene Sequence
cdgI gene sequence


Size: 1476        A: 410  T: 498  G: 273  C: 295

Fasta

 

>cdgI E. coli K12. Version NC_000913.3 GI:556503834
atgattcagtcaacacgtatttccatggggttattctttaaatattttttatcgttaacg
aaaattgatcctggtcaaaactatatatctctgccatcaataaaatccagcactcacatt
gctctcctttttatggtttctatgggtacacaaaaattaaaagctcaaagcttttttatt
ttcagtttattgctgacgttaattttattttgcattactaccttatataacgaaaacaca
aatgtaaaactcatcccacagatgaattacctgatggttgttgtggctttgtttttcctt
aacgccgtcatttttcttttcatgttaatgaaatatttcactaacaaacaaattttacca
acactcattttaagccttgcatttttaagtggccttatctatttagttgaaaccattgta
attatccataaaccaattaacggcagtacactgatccagacaaagtcgaatgatgtttct
attttctatattttccgccaactcagttttatttgtttaacctcgctggcgctcttttgt
tatggaaaagacaacatccttgacaacaataagaaaaaaacgggaatcctgttgctggcg
ctgatcccttttttagtttttccccttctggcacacaatctgagcagttataacgctgac
tattctttgtatgtcgtcgattactgtccggacaaccatactgcgacctggggaatcaac
tatacaaaaatattggtttgtctgtgggcatttttactgttctttattatcatgcgcaca
cgattagccagcgaactatggccgttaatagcattattatgtctggcatcgctatgctgc
aacttacttctactgactctggatgagtataattatactatctggtatatcagtcgcggg
attgaagtttccagtaaactgtttgttgtgtcttttctgatttataacatttttcaggag
ctgcaactctccagcaaactggcagttcatgatgtgctgaccaatatttataatcggcgc
tactttttcaacagcgtagagtcattattgtcgcgacctgttgttaaggacttctgtgtc
atgctggttgatattaatcagttcaaacgcatcaatgcccaatggggacatcgtgtgggt
gataaagtgctggtttcaattgtcgatattatccagcaaagcatccgccccgatgatatt
ttagcgcgactggagggtgaggtgtttggcttgctatttaccgaactcaatagtgcccag
gcaaaaatcattgcggaacgtatgcgtaaaaatgtcgaactcctgaccggctttagtaac
agatatgatgttcctgaacaaatgaccatcagtattggcacggttttttcaacgggtgac
acgcgtaatatctcgcttgtcatgacggaagcagataaagccttacgcgaagcgaaaagc
gaggggggcaacaaagtgattattcatcatatttaa
              
                            

Download fasta file
RegulonDB