RegulonDB RegulonDB 10.9: Gene Sequence
dgcJ gene sequence


Size: 1491        A: 396  T: 409  G: 346  C: 340

Fasta

 

>dgcJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaattgcaccatagaatgctccggcattttatcgccgcaagtgtcattgtgctgaca
tcttccttccttatttttgaacttgtcgccagcgacagagcaatgagtgcctatctgcgc
tatatcgtgcagaaagcagactcctcctttctttatgataagtatcagaatcagagtatt
gccgcgcatgtgatgcgcgctctcgctgctgagcagtcggaagtgtcgccagaacagcgg
cgcgccatctgcgaggcttttgagtctgccaataacacccatggcttaaacctgactgcc
cataaatacccgggcttacgcggcacactacaaaccgcatccactgactgcgacacaatt
gtggaagctgcagcactattacccgcttttgatcaggcagtggaaggcaaccgccaccag
gatgattacggttcaggtcttgggatggccgaagagaaatttcactattatctcgatctc
aatgaccgctatgtctatttttatgagccggttaatgttgaatactttgcgatgaataac
tggtccttcctgcagtcaggaagtattggcatcgatcgcaaagatattgaaaaggtattt
accgggcgtaccgtattgtcgagcatttaccaggatcagcgtactaaacagaacgtgatg
agtttgctgacgccggtatatgtcgcagggcagctaaaagggattgtgctgctggatatt
aacaaaaacaatctgcggaatatcttttatactcatgaccgccctctcctctggcgtttt
ctcaatgtcacgctaaccgataccgattcggggcgcgacattatcatcaaccagagcgaa
gataatctgttccagtatgtcagttacgtccatgacttaccgggcggcattcgtgtctcg
ttatccattgatattctttactttatcacgtcttcgtggaaaagcgttctgttctggatt
ttgacggcgttaattttgctgaatatggtgcggatgcacttccgtttataccaaaatgtg
tcgcgagaaaatattagtgatgcgatgactggactgtataatcgcaaaattttaacccct
gaactggagcagcggttgcagaaactggtgcaatccggttcttcggtgatgtttattgct
attgacatggacaagttaaagcaaataaatgacaccctcggtcatcaggagggggattta
gcgattacgttattagctcaggcgattaaacagtcgattcgtaaaagtgattatgccatc
cgactcggtggcgatgaattctgcatcattcttgtcgattcgacgccgcaaattgcagca
caactgcctgaacgtatcgaaaaacgtctgcaacatatcgcgccgcagaaagagatcggc
ttctcttccggtatttacgcgatgaaagaaaacgatacgttacatgatgcgtataaagct
tccgatgagcgtttatatgtcaataagcagaacaaaaacagccgttcatga
              
                            

Download fasta file
RegulonDB