RegulonDB RegulonDB 10.9: Gene Sequence
yeaK gene sequence


Size: 504        A: 127  T: 118  G: 127  C: 132

Fasta

 

>yeaK E. coli K12. Version NC_000913.3 GI:556503834
atgactgaaatggctaaaggaagcgtgacgcatcagcggttaatcgctttattatcacaa
gaaggtgctgacttccgcgtcgttacccatgaagcggtaggtaaatgtgaagcggtgtca
gaaattcgtggcaccgctctaggccagggtgctaaggcactggtatgtaaagtcaaaggc
aatggcgtaaatcaacatgttctggcgatcctcgcagccgatcaacaggccgatctgagc
caactcgccagccatataggcggattacgcgcttcgttggccagcccggcggaagtcgat
gaactcacaggctgtgtcttcggcgcgatcccccctttcagcttccatccaaaactcaaa
ctggttgccgaccctctactcttcgaacgatttgatgaaatcgccttcaatgcaggcatg
ctggataaatccgttattttgaaaaccgcggattatttgcgcattgcgcaaccagaactg
gtcaatttccgccgcactgcgtaa
              
                            

Download fasta file
RegulonDB