RegulonDB RegulonDB 10.9: Gene Sequence
yoaI gene sequence


Size: 105        A: 21  T: 39  G: 23  C: 22

Fasta

 

>yoaI E. coli K12. Version NC_000913.3 GI:556503834
atgaacgatcaaatgtttgtcgagacactgattatcacgtcatcgttttttgccattgct
gttgtactggttttgtccgttcttcttatcgaacggaccggctag
              
                            

Download fasta file
RegulonDB