RegulonDB RegulonDB 10.9: Gene Sequence
yeaL gene sequence


Size: 447        A: 76  T: 126  G: 134  C: 111

Fasta

 

>yeaL E. coli K12. Version NC_000913.3 GI:556503834
atgtttgatgtcactttgctgatcctgctcgggttagctgcgctgggctttatcagtcat
aacaccactgtcgccgtttcaattctggtgttaatcattgtccgcgtcacaccgttaagc
accttttttccgtggattgaaaaacaggggctaagtatcgggataatcattctgacgatt
ggcgttatggcccccatcgccagcgggacgctaccgccctcaaccttgattcactcgttt
ctgaactggaaatcactggtggcgattgcagtaggcgtgattgtctcctggctgggtggg
cgcggcgtgacgttaatgggcagccagccgcaactggtcgccgggctgctggtaggcact
gttttaggcgtagcgctgtttcgcggcgtaccggttgggccgcttattgccgcgggtctg
gtttcgctgattgtggggaaacagtag
              
                            

Download fasta file
RegulonDB